OCALA, FL / ACCESSWIRE / February 18, 2020 / AIM ImmunoTech (NYSE American:AIM), an immuno-pharma company focused on the research and development of therapeutics to treat immune disorders, viral diseases and multiple types of cancers, today provided its stockholders with an update on its efforts to develop Ampligen as a protective therapeutic and a vaccine in the new coronavirus epidemic. Ampligen, the company's flagship drug, has a commercial approval in Argentina, early-access therapeutic approval in the Netherlands, and is in numerous FDA-authorized clinical trials in the United States. This letter provides a detailed scientific basis for why the company is moving forward in the important and volatile Wuhan coronavirus space. The text of the letter is set forth below and also is available on the company's website.

Dear Valued Stockholder:

As you know, our primary focus over the past two years has been on Ampligen (rintatolimod) in immuno-oncology. That remains our top priority. Nevertheless, mankind is faced with its third emerging highly pathogenic and deadly human coronaviral threat in less than two decades. We are referring to the lethal Wuhan Coronavirus, in which the disease is technically known as COVID-19 (Coronavirus disease-2019), in which the first cases were observed in Wuhan, China, only two months ago. Today there are more than 60,000 cases with well over 1,000 confirmed deaths. This virus thrives in hospital-like settings. In a recent study of infections contracted in hospitals, there was a 4.3% mortality rate (https://jamanetwork.com/journals/jama/fullarticle/2761044). The urgency of the situation only increases day by day, and any mutation which increases mortality would have major global consequences in a pandemic. It is for this reason that I directed the AIM ImmunoTech team to reexamine the antiviral properties of Ampligen in conjunction with the known genomic properties of the Wuhan coronavirus and its clinical syndrome, and the potential of Ampligen to serve as a protective therapeutic in such high-risk environments.

To date, we have as step one developed the ideas behind our potential Wuhan outbreak therapy and vaccine. Next, we filed provisional Ampligen patent applications related to the Wuhan coronavirus (see: https://aimimmuno.irpass.com/AIM-ImmunoTech-Files-Three-Provisional-Patent-Applications-Surrounding-AmpligenR-for-Use-Against-the-SARS-like-Wuhan-2019-Novel-Coronavirus). Now, we are moving aggressively to bring our findings to the governments of the U.S., China and Japan.

When the Wuhan coronavirus outbreak first emerged, our AIM ImmunoTech team went to work immediately. Our drug Ampligen had excellent antiviral activity against the coronavirus SARS in U.S. National Institutes of Health (NIH)-contracted animal experiments, conferring 100% protective survival.

In the Day 2009 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2787736/) and Barnard 2006 (https://journals.sagepub.com/doi/abs/10.1177/095632020601700505) NIH studies of SARS-infected mice, Ampligen stood out as the only drug conferring a significant antiviral/survival effect. We knew, if the Wuhan virus shared key genomic and pathogenic similarities with SARS, we may have important insight into developing a potential protective early-onset therapy for this new lethal virus where currently there is no effective therapy. Again, the Wuhan coronavirus is especially virulent in hospital and institutional quarantine settings, so such prophylactic protective measures may help blunt the spread of the disease.

Rapidly, we obtained genomic RNA sequences of the new virus and compared them to the SARS virus' RNA sequences. As you will see in the section following the synopsis of the SARS experimentation with Ampligen in animals, the RNA sequences of the SARS virus in key areas of viral replication are almost identical for the Wuhan coronavirus. Therefore, we believe it is very likely that Ampligen would have similar antiviral activity against the Wuhan coronavirus as it did against the SARS-CoV. These experimental evaluations of Ampligen as an antiviral treatment for SARS took place after the last SARS outbreak about 15 years ago. At that time, Ampligen was the only therapy which, in the NIH-contracted animal experiment, conferred significant efficacy, up to 100% survival as compared to 100% mortality in the SARS infected control group. In these two studies (Barnard 2006 and Day 2009), SARS mouse models were evaluated and the Ampligen dose utilized in these studies yielded antiviral and survival effects, i.e. reduction of SARS virus lung titers below the level of detection (Barnard 2006) and increased survival (Day 2009). Importantly, these effects were obtained at clinically achievable/tolerated human dosage levels. Ampligen was the only drug active at clinically achievable serum/dosage levels (Strayer 2014 http://www.eurekaselect.com/123324/article). Barnard (2006) studied the ability of Ampligen and rIFN-αB/D to inhibit SARS virus (Urbani Strain) titers in the lungs of BALB/c mice. Complete inhibition to below detectable levels was seen with Ampligen at 10 mg/kg which is equivalent to 700 mg in an average weight human (70 kg) and has also been shown to be a generally well-tolerated dosage level (Thompson 1996 https://www.ncbi.nlm.nih.gov/pubmed/8874076). The rIFN-α B/D inhibited virus titers to below detectable level, but required a dose of 100,000 IU in mice, which is equivalent to an extremely high human dose of 500 x 106 IU, and furthermore is not clinically available. Day (2009) studied a new mouse-adapted strain of SARS-CoV as a lethal model. Only Ampligen at a dosage of 10 mg/kg/day obtained a 100% survival rate.

In summary, only Ampligen showed any significant response when evaluating protection and survival (Day 2009, Barnard 2006 and Strayer 2014). The above SARS-related experiments indicate that, unlike other drugs, Ampligen has a significant positive prophylactic early-onset therapeutic effect. Further, Ampligen has demonstrated significant synergy when combined with otherwise marginally effective antivirals to enhance antiviral therapy programs in other viruses. While there is currently no therapy for the Wuhan coronavirus, if a future traditional-based antiviral therapy is developed for this coronavirus, we believe that the combination of traditional antiviral therapies and Ampligen may produce a synergistic effect similar to what we have seen with Ampligen in other viruses that serves to improve performance, because Ampligen's immunological mechanism of action is both different and complementary to the typical antiviral. (See: "Ampligen as an Antiviral," slides 46-50, at https://aimimmuno.com/events-presentations/).

We believe the significant similarity of the Wuhan coronavirus to SARS suggests Ampligen has a high probability of a similar potential efficacy against the Wuhan coronavirus. Our analysis comparing key transcription regulatory sequences of SARS to the Wuhan coronavirus wherein we analyzed the similarity between SARS-CoV and the Wuhan coronavirus found significant and compelling similarities. Our results are listed in Table 1 and discussed below. These similarities among the analyzed sequences suggest possible extension of the antiviral effects of Ampligen seen in SARS experiments to that of Wuhan coronavirus. We provide this extra detail for those of you who are interested in a deeper analysis – however, the short story is that we have a remarkable 99% similarity in these key areas.

Coronavirus replication uses a unique transcription mechanism for the creation of nested sets of mRNAs. Selection of the correct reading frame for each mRNA is provided by transcription-regulating sequences (TRSs). Our comparison of the TRS (transcription regulatory sequences) of the first five open-reading frames (ORF) of SARS-CoV identified by Mara (2003) (https://science.sciencemag.org/content/300/5624/1399.long) to the Wuhan coronavirus responsible for COVID-19 is shown below in Table 1.

Table 1. TRS sequence comparison of two Highly Pathogenic Human Coronaviruses (HPHuCoV)

HPHuCoV

Base

ORF*

TRS Sequence**

SARS

Wuhan

60

63

Leader

UCUCUAAACGAACUUUAAAAUCUGUG

UCUCUAAACGAACUUUAAAAUCUGUG

SARS

Wuhan

21,479

21,549

S (spike)

CAACUAAACGAAC

CAACUAAACGAAC

SARS

Wuhan-

25,252

25,378

ORF3

CACAUAAACGAACUU

CACAUAAACGAACUU

SARS

Wuhan

26,104

26,232

Envelope

UGAGUACGAACUU

UGAGUACGAACUU

SARS

Wuhan

26,341

26,466

M

GGUCUAAACGAACUAACU

GGUCUAAACGAACUAAAU

*Open Reading Frame (i.e.-encodes for a protein)

**Marra, et al. https://science.sciencemag.org/content/300/5624/1399.long

We see that the TRS for the first five ORFs for the SARS-CoV (Tor2) compared to the Wuhan-CoV virus recently isolated from a patient with a SARS-like illness in China is identical with the exception of a single nucleotide (C/A) for the Membrane (M) coronavirus protein. Thus, four of the five TRS sequences (Leader, S (spike), ORF3, and Envelope) are identical for the SARS-CoV compared to the Wuhan-CoV isolate. The M protein has a single nucleotide change: the A in the SARS-CoV is changed to a C in the Wuhan-CoV. Thus, the TRS sequences of these two coronaviruses are almost identical with 84/85 nucleotides the same (99% homology).

An important pathogenic feature of SARS-CoV disease and COVID-19 is that they both utilize the same ACE2 receptor to bind to and infect a human cell. This ACE2 receptor similarity, along with the similarity of the analyzed key regulatory viral genomic sequences show, with reasonable probability, that the functional effects of Ampligen in these SARS experiments will likely extend to the Wuhan coronavirus. This is important because no effective protective therapy currently exists for a disease that is demonstrating high levels of nosocomial transmissibility – which means you easily catch it in hospital-like settings. This virus thrives in hospital-like settings. That means health care workers and exposed persons desperately need an effective protective early-onset therapeutic.

In addition to Ampligen as an antiviral, we have developed a vaccine concept, which would utilize an inactivated Wuhan/coronavirus vaccine plus Ampligen to create a vaccine that would likely immunize against the specific viral targets and would also confer cross-protection against mutations of the coronavirus and other similar coronaviruses, potentially creating, in effect, a potential universal coronavirus vaccine.

Influenza presents a meaningful analogy. The AIM-sponsored clinical results in humans seen in the Overton (2014) paper and the Ichinohe/Hasegawa (2007 and 2010) experimental results in mice and monkeys as stated in the papers show how, in influenza, Ampligen as a double-stranded RNA (dsRNA) and a generally well-tolerated selective toll-like receptor 3 (TLR3) agonist with induction of innate and adaptive immune responses has a powerful immunological impact on a vaccine's activity in mice, non-human primates and humans showing evidence of epitope spreading and cross-protection/cross-reactivity. TLR3 is expressed in high concentrations on human airway epithelial cells and serves as a recognition system initiating innate and subsequent adaptive immune responses for many respiratory pathogens.

The mucosal surface of the nose and respiratory tract serve as an ideal environment for Ampligen, as a TLR3 agonist, to exert its pronounced ability to enhance the innate and adaptive immune responses to respiratory pathogens such as influenza virus, adenovirus, and coronavirus. Indeed the intranasal instillation of inactivated or attenuated influenza viruses contained in seasonal influenza vaccination, when used in combination with Ampligen, has been shown to be able to induce a broad cross-reactivity antiviral IgA response to influenza viruses highly pathogenic to humans, such as various H5N1 clades (A/Indonesia/5/2000, A/HongKong/483/97, and A/Vietnam/1194/2004) in mice, non-human primates, and humans. See Overton 2014 https://www.sciencedirect.com/science/article/pii/S0264410X14010457?via%3Dihub, Ichinohe 2007 https://academic.oup.com/jid/article/196/9/1313/2191831, and Ichinohe 2010 https://onlinelibrary.wiley.com/doi/abs/10.1002/jmv.21824)

The unique ability of Ampligen to be able to enhance in humans the mucosal IgA response to both homologous and heterologous strains of influenza virus is dependent on the interaction at the mucosal environment with Ampligen and the foreign protein epitopes present in the viruses. This interaction results in epitope spreading to less responsive common antigens with the generation of secretory IgA (S-IgA) resulting in a very broad cross-reactivity against more distantly related clades and even strains of viruses not previously encountered. We believe this may be the key to a "universal" vaccine.

The use of intranasal vaccination for respiratory viral pathogens has several advantages over standard intramuscular (IM) or subcutaneous (SQ) approaches: 1) neutralizing antibodies can be generated at the point of respiratory entrance- the airway mucosa rather than systemic, 2) vaccination could be self-administered if required, and 3) there is the potential of epitope spreading. Our proposed vaccine contemplates inactivated Wuhan-CoV, a similar inactivated isolated virus from patients, or an antigen thereof, combined with Ampligen and administered intranasally (IN), with the generation of a mucosal S-IgA response and consequently having potentially a broad cross-reactivity against other coronaviruses, including SARS, MERS, and the Human Coronaviruses 229E, NL63, and OC43. We believe, similar to the influenza results we obtained in humans described in the above link to the Overton study and the Ichinohe/Hasegawa animal experiments, that this potentially universal coronavirus vaccine may demonstrate antiviral activity not only against currently identified coronaviruses, but also against newly emerging coronaviruses resident in wild animal populations with the potential to emerge in the future to infect human populations similarly to SARS, MERS, and Wuhan CoV, or mutations from existing coronaviruses.

Finally, as you know from our ability to deploy Ampligen in immuno-oncology clinical trials over the past two years, Ampligen has a well-developed safety profile for human use. Our safety profile involves approximately 100,000 generally well-tolerated intravenous (IV) doses in humans in FDA authorized clinical trials up through Phase 3. We have also completed a Phase 1 safety trial for intranasal administration of Ampligen, which would be highly advantageous to creating a universal intranasal coronavirus vaccine for humans (Overton 2014, see link above). Ampligen has been authorized for use in humans in numerous ongoing clinical trials (primarily in oncology) and in a long-term compassionate care program (ME/CFS) by the U.S. FDA. Ampligen has received full commercial approval (ME/CFS) from the Republic of Argentina. Ampligen has an early access use approval for use in pancreatic cancer from the Netherlands. Our drug Ampligen is generally well-tolerated, which makes it primed and ready for Wuhan coronavirus clinical trials in China or any other site with sufficient subjects.

This has been a major effort for our team over the past six weeks. As noted above, we have filed provisional patent applications to protect our ideas in applying Ampligen as a protective therapeutic and a vaccine in this newest coronavirus epidemic. We waited until our patent applications were filed to discuss in detail our efforts, so as to protect the rights to these ideas to the greatest extent possible. Now we begin the process of seeking government partners to develop Ampligen as both a protective therapy and a vaccine in China and other affected areas.

We believe our work here is very important and, especially when dealing with a potential pandemic, consistent with AIM's corporate motto: "Immunology for a better future."

All the best,

Thomas K. Equels, CEO

AIM ImmunoTech Inc.
Tel: (352) 448-7797
www.AIMimmuno.com

About AIM ImmunoTech Inc

AIM ImmunoTech Inc. is an immuno-pharma company focused on the research and development of therapeutics to treat immune disorders, viral diseases and multiple types of cancers. AIM's flagship products include the Argentina-approved drug rintatolimod (trade names Ampligen® or Rintamod®) and the FDA-approved drug Alferon N Injection®. Based on results of published, peer-reviewed pre-clinical studies and clinical trials, AIM believes that Ampligen® may have broad-spectrum anti-viral and anti-cancer properties. Clinical trials of Ampligen® include studies of cancer patients with renal cell carcinoma, malignant melanoma, colorectal cancer, advanced recurrent ovarian cancer and triple negative metastatic breast cancer. These and other potential uses will require additional clinical trials to confirm the safety and effectiveness data necessary to support regulatory approval and additional funding. Rintatolimod is a double-stranded RNA being developed for globally important debilitating diseases and disorders of the immune system.

Cautionary Statement

This press release contains forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995. Words such as "may," "will," "expect," "plan," "anticipate" and similar expressions (as well as other words or expressions referencing future events or circumstances) are intended to identify forward-looking statements. These statements involve a number of risks and uncertainties. For example, significant additional testing and trials will be required to determine whether Ampligen will be effective in the treatment of the Wuhan Coronavirus in humans and no assurance can be given that it will be the case. The press release references a number of studies. No assurance can be given that future studies will not result in findings that are different from those reported in the referenced studies. The filing of provisional patent applications provides no assurance that patents will ultimately be granted. The Company will be reaching out to numerous foreign governments and, if successful, will be working in these countries. Operating in foreign countries carries with it a number of risks, including potential difficulties in enforcing intellectual property rights. We cannot assure that our potential operations in foreign countries will not be adversely affected by these risks. Please note that certain doctors who were executives of the Company were co-authors of some of the studies referenced herein. With regard to the Company's activities with Ampligen generally, no assurance can be given as to whether current or planned trials will be successful or yield favorable data and the trials are subject to many factors including lack of regulatory approval(s), lack of study drug, or a change in priorities at the institutions sponsoring other trials. In addition, initiation of planned clinical trials may not occur secondary to many factors including lack of regulatory approval(s) or lack of study drug. Even if these clinical trials are initiated, the Company cannot assure that the clinical studies will be successful or yield any useful data or require additional funding. Any forward-looking statements set forth herein speak only as of the date of this press release. The Company does not undertake to update any of these forward-looking statements to reflect events or circumstances that occur after the date hereof. The information found on our website is not incorporated by reference herein and is included for reference purposes only.

Contacts:

Crescendo Communications, LLC
Phone: 212-671-1021
Email: aim@crescendo-ir.com

AIM ImmunoTech Inc
Phone: 800-778-4042
Email: IR@aimimmuno.com

SOURCE: AIM ImmunoTech Inc

ReleaseID: 576559

Closing of this transformative transaction expected in early Q2 2020 upon completion of remaining closing conditions and receipt of regulatory approval in Israel

RALEIGH, NC / ACCESSWIRE / February 18, 2020 / Innovate Biopharmaceuticals, Inc. (Nasdaq: INNT – "Innovate"), a clinical stage biotechnology company focused on developing novel therapeutics announced the results from its February 14, 2020 special meeting of shareholders to approve proposals related to its upcoming merger with RDD Pharma Ltd. ("RDD"). At the Meeting, the stockholders approved all three proposals and cast their votes as follows:

1. To authorize, for purposes of complying with Nasdaq Listing Rule 5635, the issuance of shares of our common stock, pursuant to the terms of that certain Agreement and Plan of Merger and Reorganization, dated October 6, 2019, by and among the Company, RDD Pharma Ltd ("RDD") and the other parties thereto, as amended by Amendment No. 1, dated December 17, 2019 (the "Merger Agreement"), in an amount in excess of 20% of our common stock outstanding before the issuance of such common stock (the "Merger Consideration Proposal"):

Votes For

Votes Against

Votes Abstained

16,224,114

79,088

11,606

2. To approve the potential issuance of 20% or more of the Company's issued and outstanding common stock pursuant to a proposed reduction in the exercise price of outstanding warrants (the "Warrants Proposal"):

Votes For

Votes Against

Votes Abstained

15,722,048

498,663

94,096

3. To authorize an amendment to the Company's Certificate of Incorporation to effect a reverse stock split of its issued and outstanding common stock at a specific ratio, within a range of 1-for-5 and 1-for-20, to be determined by the Company's Board of Directors in its sole discretion and effected, if at all, within one year of the date the proposal is approved by stockholders:

Votes For

Votes Against

Votes Abstained

23,055,748

3,257,701

125,032

Executive Chairman of Innovate, Sandeep Laumas, M.D., stated, "the Innovate team is thrilled and grateful for the overwhelming participation and support from our shareholders regarding the upcoming merger with RDD. The approval brings us much closer to the execution of what we believe will be a transformative event for all Innovate stakeholders. When the Merger is completed, we anticipate that the combination of a combined clinical pipeline, a seasoned Board of Directors and world class management and prominent healthcare-dedicated institutional investors would position the combined company, 9 Meters Biopharma, Inc. ("9 Meters") to recognize multiple value inflection points over the next 24 months."

RDD's CEO and CEO designate of 9 Meters, John Temperato, noted "With the recent approvals by the shareholders of both Innovate and RDD our vision of creating a powerful GI centric platform company with a pipeline of late development-stage therapeutic candidates is in view. Upon completion of the Merger, 9 Meters will focus on developing urgently needed treatments for specialty, rare and orphan patient populations with debilitating GI diseases." In November RDD Pharma Ltd., entered into a non-binding letter of intent ("LOI") to acquire Naia Rare Diseases ("Naia"), a biopharmaceutical company developing drugs for Short Bowel Syndrome ("SBS") and other rare gastrointestinal diseases. Mr. Temperato continued "combining the pipelines of Innovate, RDD, and Naia Rare Diseases into 9 Meters Biopharma illustrates our unwavering commitment to produce meaningful science, readouts, and inflection points for our shareholders and most importantly for patients who are not just looking to survive but to thrive."

About Innovate Biopharmaceuticals, Inc.

Innovate is a clinical stage biotechnology company focused on developing novel therapeutics for autoimmune and inflammatory diseases. Innovate's lead drug candidate, larazotide acetate, has a mechanism of action that renormalizes the dysfunctional intestinal barrier by decreasing intestinal permeability and reducing antigen trafficking, such as gliadin fragments in celiac disease, and bacterial toxins and immunogenic antigens in nonalcoholic steatohepatitis (NASH). In several diseases, including celiac disease, NASH, ASH, Crohn's disease, ulcerative colitis, irritable bowel syndrome (IBS), type 1 diabetes mellitus (T1DM), chronic kidney disease (CKD), the intestinal barrier is dysfunctional with increased permeability. On October 7, 2019 the Company announced that it had entered into a definitive merger agreement pursuant to which the Company agreed to acquire all of the outstanding capital stock of privately held RDD in an all-stock transaction. This transaction includes a concurrent capital raise led by OrbiMed Advisors LLC. After closing the Company will change its name to 9 Meters Biopharma. The transaction is expected to close early in the second quarter of 2020, subject to the completion of the remaining closing conditions and receipt of regulatory approval in Israel. For more information, please visit www.innovatebiopharma.com.

About RDD Pharma

RDD Pharma, Ltd. ("RDD"), is a privately held biopharmaceutical company focused on orphan and innovative therapies for gastrointestinal disorders. The company has two clinical stage products which serve significant unmet needs. RDD-0315 is currently in Phase 2 development for the treatment of fecal incontinence in spinal cord injury patients. RDD-0315 has received Orphan Drug status in the E.U. and Fast Track designation in the U.S. RDD-1609 is being developed for the treatment of Pruritus Ani. For more information, please visit www.rddpharma.com.

Forward Looking Statements

This press release includes forward-looking statements based upon Innovate's and RDD's current expectations. Forward-looking statements involve risks and uncertainties, and include, but are not limited to, statements about the structure, timing and completion of the proposed Merger; the combined company's listing on Nasdaq after closing of the proposed Merger; expectations regarding the ownership structure of the combined company; the expected executive officers and directors of the combined company; the combined company's expected cash position at the closing of the proposed Merger; expectations regarding the financing; the future operations of the combined company; the nature, strategy and focus of the combined company; the development and commercial potential and potential benefits of any product candidates of the combined company; the executive and board structure of the combined company; the location of the combined company's corporate headquarters; anticipated preclinical and clinical drug development activities and related timelines, including the expected timing for data and other clinical and preclinical results; the company having sufficient resources to advance its pipeline; and other statements that are not historical fact. Actual results and the timing of events could differ materially from those anticipated in such forward-looking statements as a result of these risks and uncertainties, which include, without limitation: (i) the risk that the conditions to the closing of the proposed Merger are not satisfied; (ii) uncertainties as to the timing of the consummation of the proposed Merger and the ability of each of Innovate and RDD to consummate the proposed Merger; (iii) risks related to Innovate's ability to manage its operating expenses and its expenses associated with the proposed Merger pending closing; (iv) risks related to the failure or delay in obtaining required approvals from any governmental or quasi-governmental entity necessary to consummate the proposed Merger; (v) the risk that as a result of adjustments to the exchange ratio, Innovate stockholders and RDD stockholders could own more or less of the combined company than is currently anticipated; (vi) risks related to the market price of Innovate common stock relative to the exchange ratio; (vii) unexpected costs, charges or expenses resulting from the transaction; (viii) potential adverse reactions or changes to business relationships resulting from the announcement or completion of the proposed Merger; (ix) the uncertainties associated with the clinical development and regulatory approval of product candidates; (x) risks related to the inability of the combined company to obtain sufficient additional capital to continue to advance these product candidates and its preclinical programs; (xi) uncertainties in obtaining successful clinical results for product candidates and unexpected costs that may result therefrom; (xii) risks related to the failure to realize any value from product candidates and preclinical programs being developed and anticipated to be developed in light of inherent risks and difficulties involved in successfully bringing product candidates to market; and (xiii) risks associated with the possible failure to realize certain anticipated benefits of the proposed Merger, including with respect to future financial and operating results. Actual results and the timing of events could differ materially from those anticipated in such forward-looking statements as a result of these risks and uncertainties. These and other risks and uncertainties are more fully described in periodic filings with the SEC, including the factors described in the section entitled "Risk Factors" in Innovate's Quarterly Report on Form 10-Q for the quarter ended September 30, 2019 filed with the SEC, and in other filings that Innovate has made and will make with the SEC. You should not place undue reliance on these forward-looking statements, which are made only as of the date hereof or as of the dates indicated in the forward-looking statements. Innovate expressly disclaims any obligation or undertaking to release publicly any updates or revisions to any forward-looking statements contained herein to reflect any change in its expectations with regard thereto or any change in events, conditions or circumstances on which any such statements are based.

Contact:

Innovate Biopharmaceuticals, Inc.
Edward J Sitar
Chief Financial Officer
Tel: +1.201.320.4242
Email: esitar@innovatebiopharma.com
www.innovatebiopharma.com

Jennifer K. Zimmons, Ph.D.
Investor Relations
Tel: +1.917.214.3514
Email: jzimmons@innovatebiopharma.com
www.innovatebiopharma.com

RDD Pharma, Ltd.

John Temperato
Email: jtemperato@rddpharma.com
www.rddpharma.com

SOURCE: Innovate Biopharmaceuticals, Inc.

ReleaseID: 576685

NEW YORK, NY / ACCESSWIRE / February 18, 2020 / Fluor Corp. (NYSE:FLR) will be discussing their earnings results in their 2019 Fourth Quarter Earnings call to be held on February 18, 2020 at 8:30 AM Eastern Time.

To listen to the event live or access a replay of the call – visit https://www.investornetwork.com/event/presentation/58235

To receive updates for this company you can register by emailing info@investornetwork.com or by clicking get investment info from the company's profile.

About Investor Network

Investor Network (IN) is a financial content community, serving millions of unique investors market information, earnings, commentary and news on the what's trending. Dedicated to both the professional and the average traders, IN offers timely, trusted and relevant financial information for virtually every investor. IN is an Issuer Direct brand, to learn more or for the latest financial news and market information, visit www.investornetwork.com. Follow us on Twitter @investornetwork.

SOURCE: Investor Network

ReleaseID: 576684

NEW YORK, NY / ACCESSWIRE / February 18, 2020 / Ansell Ltd. (OTCMKTS:ANSLF) will be discussing their earnings results in their 2020 First Half Earnings call to be held on February 18, 2020 at 8:00 AM Eastern Time.

To listen to the event live or access a replay of the call – visit https://www.investornetwork.com/event/presentation/59726

To receive updates for this company you can register by emailing info@investornetwork.com or by clicking get investment info from the company's profile.

About Investor Network

Investor Network (IN) is a financial content community, serving millions of unique investors market information, earnings, commentary and news on the what's trending. Dedicated to both the professional and the average traders, IN offers timely, trusted and relevant financial information for virtually every investor. IN is an Issuer Direct brand, to learn more or for the latest financial news and market information, visit www.investornetwork.com. Follow us on Twitter @investornetwork.

SOURCE: Investor Network

ReleaseID: 576663

NEW YORK, NY / ACCESSWIRE / February 18, 2020 / Electrovaya, Inc. (OTCMKTS:EFLVF) will be discussing their earnings results in their 2020 First Quarter Earnings call to be held on February 18, 2020 at 8:00 AM Eastern Time.

To listen to the event live or access a replay of the call – visit https://www.investornetwork.com/event/presentation/59419

To receive updates for this company you can register by emailing info@investornetwork.com or by clicking get investment info from the company's profile.

About Investor Network

Investor Network (IN) is a financial content community, serving millions of unique investors market information, earnings, commentary and news on the what's trending. Dedicated to both the professional and the average traders, IN offers timely, trusted and relevant financial information for virtually every investor. IN is an Issuer Direct brand, to learn more or for the latest financial news and market information, visit www.investornetwork.com. Follow us on Twitter @investornetwork.

SOURCE: Investor Network

ReleaseID: 576667

NEW YORK, NY / ACCESSWIRE / February 18, 2020 / Glencore Plc (OTCMKTS:GLNCY) will be discussing their earnings results in their 2019 Second Half Earnings call to be held on February 18, 2020 at 8:00 AM Eastern Time.

To listen to the event live or access a replay of the call – visit https://www.investornetwork.com/event/presentation/58953

To receive updates for this company you can register by emailing info@investornetwork.com or by clicking get investment info from the company's profile.

About Investor Network

Investor Network (IN) is a financial content community, serving millions of unique investors market information, earnings, commentary and news on the what's trending. Dedicated to both the professional and the average traders, IN offers timely, trusted and relevant financial information for virtually every investor. IN is an Issuer Direct brand, to learn more or for the latest financial news and market information, visit www.investornetwork.com. Follow us on Twitter @investornetwork.

SOURCE: Investor Network

ReleaseID: 576673

Offering inexpensive intelligent lighting control to existing light switches all while maintaining property aesthetics

WAUKESHA, WI / ACCESSWIRE / February 18, 2020 / Telkonet, Inc. (OTCQB:TKOI) (the "Company" or "Telkonet"), creator of the EcoSmart platform of intelligent automation solutions designed to optimize comfort, energy efficiency and guest experience has released the innovative EcoInput, an intelligent energy management lighting controller and the newest addition to Telkonet's extensive line of intelligent, commercial IoT devices. The EcoInput controller is installed directly in line with existing light switches, making them intelligent and manageable. IoT solutions are no longer restricted by interior design limitations, which mandate that specific light switches be featured in guest rooms.

Telkonet's EcoInput adds intelligent automation to existing light switches

Owners can eliminate unnecessary spending on the upgrade of existing light switches. With the EcoInput, light switches become "smart" at a fraction of the cost. The EcoInput does not require a neutral connection. One EcoInput can be wired to one switch, or as a three-way switch configuration. Compatible with LED, CFL, and incandescent lighting for enhanced dimming controls

"An ability to recognize customer preference while traveling and also maximizing a commercial property's energy efficiency are guiding principles of Telkonet's development," stated Jason Tienor, Telkonet CEO. "The EcoInput is EcoSmart's newest intelligent device enabling Telkonet customers to create new, immersive intelligent experiences for guests while providing an ROI through incentives and property savings."

The EcoInput will also assist properties in implementing Title 24 compliant projects by pairing the EcoSmart thermostat with an EcoInput lighting controller. Using an EcoInput as the first switch in the lighting circuit is a cost-effective and compliant Title 24 solution. The EcoInput is installed with your existing wall switch, allowing you to upgrade to smart lighting without changing your current property look and feel. When the thermostat sensor detects the room is unoccupied, it wirelessly controls the switch to deactivate the lighting circuit. It can readily serve as the room's master switch.

With the EcoInput and EcoSmart platform, a load shed event can be transparent to occupants, maintaining room comfort while conforming to Title 24 regulations. Through the networking capabilities of the system, the temperatures in occupied rooms can also be adjusted to optimize kW reductions.

The EcoInput is Zigbee HA compliant, so it can communicate with all other HA compliant devices, making it as flexible as Telkonet's other EcoSmart devices in third-party interoperability.

ABOUT TELKONET

Telkonet, Inc. (OTCQB: TKOI) provides innovative intelligent automation platforms at the forefront of the Internet of Things (IoT) space. Helping commercial audiences better manage operational costs, the Company's EcoSmart intelligent automation platform is supported by a full-suite of IoT-connected devices that provide in-depth energy usage information and analysis, allowing building operators to reduce energy expenses. Vertical markets that benefit from EcoSmart products include hospitality, education, military, government, healthcare, and multiple dwelling housing. Telkonet was founded in 1977 and is based in Waukesha, WI. For more information, visit www.telkonet.com.

For news updates as they happen, follow @Telkonet on Twitter.

To receive updates on all of Telkonet's developments, sign up for our email alerts HERE.

FORWARD-LOOKING STATEMENTS

Statements included in this release may constitute forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995. Such statements involve a number of risks and uncertainties such as competitive factors, technological development, market demand and the Company's ability to obtain new contracts and accurately estimate net revenue due to variability in size, scope and duration of projects, and internal issues in the sponsoring client. Further information on potential factors that could affect the Company's financial results, can be found in the Company's Annual Report on Form 10-K for the year ended December 31, 2017, as may be amended or supplemented in the Company's subsequently filed Quarterly Reports on Form 10-Q, and in its Reports on Form 8-K filed with the Securities and Exchange Commission.

Media Contacts:

Telkonet Investor Relations
414.302.2298
ir@telkonet.com

SOURCE: Telkonet, Inc.

ReleaseID: 576677

LAKEWOOD, CO / ACCESSWIRE / February 18, 2020 / General Moly, Inc. (General Moly or the "Company") (NYSE:GMO)(TSX:GMO), the only western-exchange listed, pure-play molybdenum ("moly") mineral development company, announced that molybdenum ("moly") spot prices have outperformed the vast majority of metal and energy commodities so far in 2020. The current weekly moly price per pound of $10.65 increased 11% in the past month, 16% year to date, and recovered 29% from the low seen in 4Q 2019, according to Platts' prices.

While most metals and energy prices have declined in the past month in the face of the coronavirus ("COVID-19") outbreak in China and the associated global health threat's potential impact on demand, moly has been a bright spot that BMO Global Commodities Research noted as bucking the broad commodities' downtrend. Other non-agricultural commodities bucking the trend include vanadium, thermal coal and gold. "One market we always look to as a guide to underlying physical conditions is molybdenum. This is a commodity where the financial market has no real ability to influence price," BMO research stated on February 7, 2020.

During 2019, moly prices averaged $11.34 per pound ("lb")and were range bound between a high of $12.70 per pound in March to a softening in late 2019, down to $8.28 per pound.

Chart 1: Moly Compared with Commodities and US Dollar Performance

Source: All except for moly, relies on BarChart.com using March 2020 or April 2020 contracts on Nymex, Comex or LME, and using ICE for the US dollar index. Moly performance was derived from Platts' prices.

Robust Moly Fundamentals for 2020

Bruce D. Hansen, Chief Executive Officer of General Moly, commented, "Moly prices have been generally resilient. For 2020, the CPM Group ("CPM") estimates an average moly real price of $12.58 per lb and nominal price of $12.87 per lb (using a base of 2019), surpassing the look-back10-year average of approximately $11.00. CPM projects that with a structural supply deficit deepening, the real price per pound is estimated to rise to an average $14.25 and a nominal price of $15.63 for the five-year period, 2021-2025. This is compared with the look- back 15‑year average price is $15.75 per lb.

"CPM currently anticipates that overall moly supply in 2019 was flat compared with 2018 with a shortfall projected in 2020, and the sharpest shortfall in 2021, as shown in Chart 3 below. CPM also has noted the shortage of new moly production in the global pipeline of projects, whether from primary sources or new copper by-product mines."

Mr. Hansen continued, "In conjunction with an anticipated strengthening of moly market fundamentals, our Company and our financial advisors are pursuing strategic alternatives to realize the enhanced value of our fully-permitted 80%-owned Mt. Hope moly project in Nevada, including seeking project financing to develop this next generation, world-class moly mine."

As moly production reported by companies and governments is updated for the full year 2019, CPM anticipates flatlining moly production in 2019 driven by falling by-product production from Chilean copper producers, including Codelco and the Sierra Gorda mine, and an approximately 5% year-over-year decline in largely primary production from Freeport McMoRan, the largest western moly producer. Such decreases will offset higher production from Bingham Canyon mine in Utah, Zangezur mine in Armenia and a slight increase in Chinese primary production in 2019. Further details about the moly market are also available in the Company's January 21, 2020 news release.

China factors into both sides of the moly supply and demand equation as it is both the largest producer and consumer of moly. Curtailment of transportation and suspension of many business operations in China may temporarily disrupt the moly market, with potential positive or negative implications to prices.

CPM also projects average real price of $13.88 and nominal price of $17.02 for 2026-2030. CPM is a metals research, econometrics, and consulting firm based in New York.

Chart 2: Weekly Moly Prices from January 6, 2005 to February 14, 2020

Source: Platts data.

Chart 3: Moly Supply and Demand Balance and Prices to 2030

Source: CPM.

About General Moly

General Moly is a U.S.-based, molybdenum mineral exploration and development company listed on the NYSE American, previously known as the NYSE MKT and former American Stock Exchange, and the Toronto Stock Exchange under the symbol GMO. The Company's primary asset, an 80% interest in the Mt. Hope Project located in central Nevada, is considered one of the world's largest and highest grade molybdenum deposits. Combined with the Company's wholly-owned Liberty Project, a molybdenum and copper property also located in central Nevada, General Moly's goal is to become the largest primary molybdenum producer in the world.

Molybdenum is a metallic element used primarily as an alloy agent in steel manufacturing. When added to steel, molybdenum enhances steel strength, resistance to corrosion and extreme temperature performance. In the chemical and petrochemical industries, molybdenum is used in catalysts, especially for cleaner burning fuels by removing sulfur from liquid fuels, and in corrosion inhibitors, high performance lubricants and polymers.

Contact:

Scott Roswell
(303) 928-8591
info@generalmoly.com
Website: www.generalmoly.com

Forward-Looking Statements

Statements herein that are not historical facts are "forward-looking statements" within the meaning of Section 27A of the Securities Act, as amended and Section 21E of the Securities Exchange Act of 1934, as amended and are intended to be covered by the safe harbor created by such sections. Such forward-looking statements involve a number of risks and uncertainties that could cause actual results to differ materially from those projected, anticipated, expected, or implied by the Company. These risks and uncertainties include, but are not limited to availability of cash to continue ongoing operations, availability of insurance, metals price and production volatility, global economic conditions, currency fluctuations, increased production costs and variances in ore grade or recovery rates from those assumed in mining plans, exploration risks and results, reclamation risks, political, operational and project development risks, ability to maintain required federal and state permits to continue construction, and commence production of molybdenum, copper, silver, lead or zinc, ability to identify any economic mineral reserves of copper, silver, lead or zinc; ability of the Company to obtain approval of its joint venture partner at the Mt. Hope Project in order to mine for molybdenum, copper, silver, lead or zinc, ability to raise required project financing or funding to pursue an exploration program related to potential copper, silver lead or zinc deposits at Mt. Hope, ability to respond to adverse governmental regulation and judicial outcomes, and ability to maintain and /or adjust estimates related to cost of production, capital, operating and exploration expenditures. For a detailed discussion of risks and other factors that may impact these forward looking statements, please refer to the Risk Factors and other discussion contained in the Company's quarterly and annual periodic reports on Forms 10-Q and 10-K, on file with the SEC. The Company undertakes no obligation to update forward-looking statements.

SOURCE: General Moly, Inc.

ReleaseID: 576774

VANCOUVER, BC / ACCESSWIRE / February 18, 2020 / Doubleview Capital Corp. ("Doubleview") (TSXV:DBV)(FRANKFURT:1D4)(OTC:DBLVF) is pleased to provide an update regarding recent exploration at its Hat gold-copper porphyry property in northwestern British Columbia.

Doubleview in late 2019 drilled five holes with total length 2,227 metres and is awaiting core sample assays. Results will be provided in a news release following receipt and verification. As previously reported, work in 2018 and 2019 included surface surveys and a 3D induced polarization geophysical survey, that greatly enhanced the exploration model and, in part, guided the recent drilling. Newly generated geological information from drill holes has been added to the property database and is being used in planning the 2020 exploration program, details of which will be announced when the forthcoming analytical data has been received and incorporated into our model. We expect the new assays to significantly increase the footprint of the Hat Deposit as well as its depth profile.

We expect to complete the 2020 exploration plan before Doubleview's representatives attend the PDAC ("Prospector & Developers Association of Canada") conference that begins in Toronto, Canada on March 1st. The PDAC is one of the world's largest exploration and mining forums and is a unique opportunity for participants, including industry leaders from all over the world, to network and show case their company's accomplishments. Doubleview will highlight details of its recent progress at the Hat Gold-Copper project.

Doubleview is pleased to note the significant increase in the world price of gold during the last year that adds much value to Hat property mineralization, as well as the growing usage of copper, particularly in the rapidly expanding market for electric automobiles and in renewable energies that are being developed in response to concerns related to climate change.

Please note that Doubleview's corporate office will move to the following address effective March 1st, 2020: 470 Granville Street, Suite 822, Vancouver, BC, V6C 1V5.

Please view the Hat presentation on youtube at: https://www.youtube.com/watch?v=a57UBBYjI-4&t=2s .

About Doubleview Capital Corp.

Doubleview Capital Corp., a mineral resource exploration and development company, is based in Vancouver, British Columbia, Canada, and is publicly traded on the TSX-Venture Exchange [TSX-V: DBV], [OTCBB: DBLVF], [GER: A1W038], [Frankfurt: 1D4]. Doubleview identifies, acquires and finances precious and base metal exploration projects in North America, particularly in British Columbia.

On behalf of the Board of Directors,
Farshad Shirvani, President & Chief Executive Officer

For further information please contact: (after March 1, 2020)

Doubleview Capital Corp.
470 Granville St., Suite #822
Vancouver, BC V6C 1V5

Farshad Shirvani, President & CEO
T: (604) 678-9587
E: corporate@doubleview.ca

Forward-Looking Statements

Information set forth in this news release contains forward-looking statements that are based on assumptions as of the date of this news release. These statements reflect management's current estimates, beliefs, intentions and expectations. They are not guarantees of future performance. Doubleview cautions that all forward looking statements are inherently uncertain and that actual performance may be affected by a number of material factors, many of which are beyond Doubleview's control. Such factors include, among other things: risks and uncertainties relating to Doubleview's limited operating history and the need to comply with environmental and governmental regulations. Accordingly, actual and future events, conditions and results may differ materially from the estimates, beliefs, intentions and expectations expressed or implied in the forward looking information. Except as required under applicable securities legislation, Doubleview undertakes no obligation to publicly update or revise forward-looking information.

NEITHER THE TSX VENTURE EXCHANGE NOR ITS REGULATION SERVICES PROVIDER (AS THAT TERM IS DEFINED IN THE POLICIES OF THE TSX VENTURE EXCHANGE) ACCEPTS RESPONSIBILITY FOR THE ADEQUACY OR ACCURACY OF THIS RELEASE.

SOURCE: Doubleview Capital Corp.

ReleaseID: 576792

Mobile News: Motorola's latest G-series phones are bigger, better, and budget-friendlier than ever

NEW YORK, NY / ACCESSWIRE / February 18, 2020 / B&H Photo is excited to share the announcement of two new Motorola smartphones, the Moto G8 Power and G Stylus. The Moto G series has long been known for offering some of the best value and bang-for-buck performance on the market, and both of these phones look to continue that reputation, thanks to bigger displays, better processors, and beefed-up camera systems-all without overburdening your wallet.

Starting with the Moto G8 Power: The aptly named smartphone boasts a non-removable 5,000mAh battery, meaning users can expect days-not just hours-of uninterrupted usage off a single charge. Of course, the "power" moniker covers more than just the battery. The new smartphone also packs a robust camera setup that includes an AI-assisted quad camera system on the back (16MP wide, 8MP telephoto, 8MP ultrawide, and a 2MP dedicated macro lens) and a 16MP selfie lens on the front. The G8 Power's FHD+ display measures in at 6.4", with a screen resolution of 1080 x 2300 and 19:9 aspect ratio. Like its predecessors, the G8 Power runs a near-stock version of the latest Android OS-this time around it's Android 10.0-with a few Motorola-specific flourishes skinned over the software. Beneath the G8 Power's hood is a very capable Snapdragon 665 chipset, which isn't the most cutting-edge CPU available, but it's plenty to guarantee strong, reliable performance. For storage, the G8 Power comes with 4GB of RAM, 64GB of internal memory, and it supports microSDXC cards, just in case you need additional room.

Moto G Stylus 128GB Smartphone https://www.bhphotovideo.com/c/product/1545349-REG/moto_pah10005us_moto_g_stylus_128gb.html

GSM + CDMA / 4G LTE Compatible
North American Variant
48MP Wide + Night Vision Mode
16MP Ultra-Wide & Dedicated Macro Camera
Up to 4K UHD Video Capture
Snapdragon 665 Octa-Core CPU
128GB Storage Capacity + 4GB of RAM
6.4" 2300 x 1080 IPS LCD Display
Built-In Pop-Out Stylus
Android 10.0 Operating System

The G Stylus is an exciting new entry into the Moto G family. In terms of specs, it's similar to the G Power in many categories: It has the same screen size, same processor, and the same amount of RAM. However, there are some very notable differences between the two phones. Let's start with the obvious: the stylus. As you no doubt have guessed, the Moto G Stylus does indeed come with its very own built-in stylus-a first for Motorola. It's a pretty standard stylus, as far as styli go, you can use it to draw, take photos, etc. But considering the fact that smartphones with built-in styluses are pretty rare and those phones that do have styluses cost three times as much, it's a pretty impressive feature. The other big difference between the G8 Power and the G Stylus is the camera system. The G Stylus's camera system is a bit more powerful than the G8 Power's setup. The G Stylus's rear system features a 48MP quad-pixel main camera, a 16MP ultrawide, and the dedicated 2MP macro lens. Like the G8 Power, it also has a hole-punched 16MP selfie camera on the front. Lastly, the G Stylus does come with more memory than the G8 Power-128GB vs. 64GB-which justifies its slightly higher cost.

Neither the G8 Power nor G Stylus support NFC or wireless charging, which could be a drawback for some customers. Those missing features aside, both phones look primed to be among the best budget phones of the year thanks to their exhaustive suite of features and modest price tags.

About B&H Photo Video

As the world's largest source of photography, video, and audio equipment, as well as computers, drones, and home and portable entertainment, B&H is known worldwide for its attentive, knowledgeable sales force and excellent customer service, including fast, reliable shipping. B&H has been satisfying customers worldwide for 40 years.

Visitors to the website can access a variety of educational videos and enlightening articles. The B and H YouTube Channel has an unmatched wealth of educational content. Our entertaining and informative videos feature product overviews from our in-house specialists. You can view the B&H Event Space presentations from many of the world's foremost experts and interviews with some of technology's most dynamic characters. Tap into this exciting resource by subscribing to the B&H YouTube Channel here. In addition to videos, the B&H Explora blog presents new product announcements, gear reviews, helpful guides, and tech news written by product experts and industry professionals.

When you're in Manhattan, take a tour of the B&H Photo SuperStore, located at 420 Ninth Avenue. The techno-carousel spins all year round at the counters and kiosks at B&H. With hundreds of products on display, the B&H Photo SuperStore is the place to test-drive and compare all the latest gear.

CONTACT:

Henry Posner
B&H Photo Video
212-615-8820
https://www.bhphotovideo.com/

SOURCE: B&H Photo Video

ReleaseID: 576688